Plasmid Preparation:Article Title: Random Mutagenesis Identifies Novel Genes Involved in the Secretion of Antimicrobial, Cell Wall-Lytic Enzymes by Lactococcus lactis
Article Snippet: .. Strains, plasmids, and oligonucleotides used in this study Strain, plasmid, or oligonucleotide Details Source, reference, orpurpose Strains E. coli JM109 Cloning host Promega L. lactis MG1363 Plasmid-free L. lactis subsp. cremoris 10 L. lactis MG1363 lss MG1363 carrying the lss cassette on the chromosome This study L. monocytogenes ATCC 19112 Human spinal fluid isolate ATCC S. aureus ATCC 49476 Methicillin-resistant S. aureus 39 Plasmids pBluescript II KSAmpr; 3.0 kb Promega pGEM-3Zf Ampr; 3.2 kb Promega pGEM-T Easy Ampr; 3.0 kb Promega pGhost9:ISS1 Emr ori (Ts); 4.6 kb; nonreplicative in L. lactis at 37°C 19 pSep-6 His-Lss Ampr; pGEM-3Zf containing the PSep–ssSep–six-histidine–lss expression construct (5.3 kb) 39 pBS-his1 Ampr; pBS containing a fragment of the MG1363 his operon on the 5 end of the lss cassette (4.2 kb) This study pGT-his2 Ampr; pGEM-T Easy containing a fragment of the MG1363 his operon on the 3 end of the lss cassette (4.2 kb) This study pGT-his1-lss-his2 Ampr; pGEM-T Easy vector containing the lss cassette within the his operon (6.9 kb) This study pG9-his1-lss-his2 Emr; pGhost9:ISS1 containing the lss cassette within the his operon (7.6 kb) This study pSep511sec Emr; pGhost:ISS1 containing the PSep–ssSep–six-histidine–Ply511 expression construct (5.5 kb) 39 Oligonucleotides His1Sal5 CAGGTCGACCTTTGGGAGTCGCCTTTGGCT Amplification of his1 His1Xba3 TACTCTAGACTGAAACATCAGCCCAGTATA His2Xho5 AGACTCGAGGGCGCAAGCGACTATATCCGG Amplification of his2 His2Eco3 TTCGAATTCTTCTTCGCGCTCCTTGCGGTG lss-Pst AACAGCTGCAGGAGCTGCAACACATGAACATTC 39 His2-DS TGTGATTTGGTACGACGCAGAATTCTAAAGT Amplification of integrated lss ISS1-seq1 CACGATAGCTTAGATTGTAACG 19 ISS1-seq2 GAACCGAAGAAATGGAACGCTC 19 on M arch 22, 2015 by N O R T H E A S T E R N U N IV http://aem .asm .org/ D ow nloaded from was sequenced using primer ISS1-seq1 for the EcoRI chromosomal junction or ISS1-seq2 for the HindIII junction (Table 1). ..
Cloning:Article Title: Random Mutagenesis Identifies Novel Genes Involved in the Secretion of Antimicrobial, Cell Wall-Lytic Enzymes by Lactococcus lactis
Article Snippet: .. Strains, plasmids, and oligonucleotides used in this study Strain, plasmid, or oligonucleotide Details Source, reference, orpurpose Strains E. coli JM109 Cloning host Promega L. lactis MG1363 Plasmid-free L. lactis subsp. cremoris 10 L. lactis MG1363 lss MG1363 carrying the lss cassette on the chromosome This study L. monocytogenes ATCC 19112 Human spinal fluid isolate ATCC S. aureus ATCC 49476 Methicillin-resistant S. aureus 39 Plasmids pBluescript II KSAmpr; 3.0 kb Promega pGEM-3Zf Ampr; 3.2 kb Promega pGEM-T Easy Ampr; 3.0 kb Promega pGhost9:ISS1 Emr ori (Ts); 4.6 kb; nonreplicative in L. lactis at 37°C 19 pSep-6 His-Lss Ampr; pGEM-3Zf containing the PSep–ssSep–six-histidine–lss expression construct (5.3 kb) 39 pBS-his1 Ampr; pBS containing a fragment of the MG1363 his operon on the 5 end of the lss cassette (4.2 kb) This study pGT-his2 Ampr; pGEM-T Easy containing a fragment of the MG1363 his operon on the 3 end of the lss cassette (4.2 kb) This study pGT-his1-lss-his2 Ampr; pGEM-T Easy vector containing the lss cassette within the his operon (6.9 kb) This study pG9-his1-lss-his2 Emr; pGhost9:ISS1 containing the lss cassette within the his operon (7.6 kb) This study pSep511sec Emr; pGhost:ISS1 containing the PSep–ssSep–six-histidine–Ply511 expression construct (5.5 kb) 39 Oligonucleotides His1Sal5 CAGGTCGACCTTTGGGAGTCGCCTTTGGCT Amplification of his1 His1Xba3 TACTCTAGACTGAAACATCAGCCCAGTATA His2Xho5 AGACTCGAGGGCGCAAGCGACTATATCCGG Amplification of his2 His2Eco3 TTCGAATTCTTCTTCGCGCTCCTTGCGGTG lss-Pst AACAGCTGCAGGAGCTGCAACACATGAACATTC 39 His2-DS TGTGATTTGGTACGACGCAGAATTCTAAAGT Amplification of integrated lss ISS1-seq1 CACGATAGCTTAGATTGTAACG 19 ISS1-seq2 GAACCGAAGAAATGGAACGCTC 19 on M arch 22, 2015 by N O R T H E A S T E R N U N IV http://aem .asm .org/ D ow nloaded from was sequenced using primer ISS1-seq1 for the EcoRI chromosomal junction or ISS1-seq2 for the HindIII junction (Table 1). ..
Expressing:Article Title: Random Mutagenesis Identifies Novel Genes Involved in the Secretion of Antimicrobial, Cell Wall-Lytic Enzymes by Lactococcus lactis
Article Snippet: .. Strains, plasmids, and oligonucleotides used in this study Strain, plasmid, or oligonucleotide Details Source, reference, orpurpose Strains E. coli JM109 Cloning host Promega L. lactis MG1363 Plasmid-free L. lactis subsp. cremoris 10 L. lactis MG1363 lss MG1363 carrying the lss cassette on the chromosome This study L. monocytogenes ATCC 19112 Human spinal fluid isolate ATCC S. aureus ATCC 49476 Methicillin-resistant S. aureus 39 Plasmids pBluescript II KSAmpr; 3.0 kb Promega pGEM-3Zf Ampr; 3.2 kb Promega pGEM-T Easy Ampr; 3.0 kb Promega pGhost9:ISS1 Emr ori (Ts); 4.6 kb; nonreplicative in L. lactis at 37°C 19 pSep-6 His-Lss Ampr; pGEM-3Zf containing the PSep–ssSep–six-histidine–lss expression construct (5.3 kb) 39 pBS-his1 Ampr; pBS containing a fragment of the MG1363 his operon on the 5 end of the lss cassette (4.2 kb) This study pGT-his2 Ampr; pGEM-T Easy containing a fragment of the MG1363 his operon on the 3 end of the lss cassette (4.2 kb) This study pGT-his1-lss-his2 Ampr; pGEM-T Easy vector containing the lss cassette within the his operon (6.9 kb) This study pG9-his1-lss-his2 Emr; pGhost9:ISS1 containing the lss cassette within the his operon (7.6 kb) This study pSep511sec Emr; pGhost:ISS1 containing the PSep–ssSep–six-histidine–Ply511 expression construct (5.5 kb) 39 Oligonucleotides His1Sal5 CAGGTCGACCTTTGGGAGTCGCCTTTGGCT Amplification of his1 His1Xba3 TACTCTAGACTGAAACATCAGCCCAGTATA His2Xho5 AGACTCGAGGGCGCAAGCGACTATATCCGG Amplification of his2 His2Eco3 TTCGAATTCTTCTTCGCGCTCCTTGCGGTG lss-Pst AACAGCTGCAGGAGCTGCAACACATGAACATTC 39 His2-DS TGTGATTTGGTACGACGCAGAATTCTAAAGT Amplification of integrated lss ISS1-seq1 CACGATAGCTTAGATTGTAACG 19 ISS1-seq2 GAACCGAAGAAATGGAACGCTC 19 on M arch 22, 2015 by N O R T H E A S T E R N U N IV http://aem .asm .org/ D ow nloaded from was sequenced using primer ISS1-seq1 for the EcoRI chromosomal junction or ISS1-seq2 for the HindIII junction (Table 1). ..
Construct:Article Title: Random Mutagenesis Identifies Novel Genes Involved in the Secretion of Antimicrobial, Cell Wall-Lytic Enzymes by Lactococcus lactis
Article Snippet: .. Strains, plasmids, and oligonucleotides used in this study Strain, plasmid, or oligonucleotide Details Source, reference, orpurpose Strains E. coli JM109 Cloning host Promega L. lactis MG1363 Plasmid-free L. lactis subsp. cremoris 10 L. lactis MG1363 lss MG1363 carrying the lss cassette on the chromosome This study L. monocytogenes ATCC 19112 Human spinal fluid isolate ATCC S. aureus ATCC 49476 Methicillin-resistant S. aureus 39 Plasmids pBluescript II KSAmpr; 3.0 kb Promega pGEM-3Zf Ampr; 3.2 kb Promega pGEM-T Easy Ampr; 3.0 kb Promega pGhost9:ISS1 Emr ori (Ts); 4.6 kb; nonreplicative in L. lactis at 37°C 19 pSep-6 His-Lss Ampr; pGEM-3Zf containing the PSep–ssSep–six-histidine–lss expression construct (5.3 kb) 39 pBS-his1 Ampr; pBS containing a fragment of the MG1363 his operon on the 5 end of the lss cassette (4.2 kb) This study pGT-his2 Ampr; pGEM-T Easy containing a fragment of the MG1363 his operon on the 3 end of the lss cassette (4.2 kb) This study pGT-his1-lss-his2 Ampr; pGEM-T Easy vector containing the lss cassette within the his operon (6.9 kb) This study pG9-his1-lss-his2 Emr; pGhost9:ISS1 containing the lss cassette within the his operon (7.6 kb) This study pSep511sec Emr; pGhost:ISS1 containing the PSep–ssSep–six-histidine–Ply511 expression construct (5.5 kb) 39 Oligonucleotides His1Sal5 CAGGTCGACCTTTGGGAGTCGCCTTTGGCT Amplification of his1 His1Xba3 TACTCTAGACTGAAACATCAGCCCAGTATA His2Xho5 AGACTCGAGGGCGCAAGCGACTATATCCGG Amplification of his2 His2Eco3 TTCGAATTCTTCTTCGCGCTCCTTGCGGTG lss-Pst AACAGCTGCAGGAGCTGCAACACATGAACATTC 39 His2-DS TGTGATTTGGTACGACGCAGAATTCTAAAGT Amplification of integrated lss ISS1-seq1 CACGATAGCTTAGATTGTAACG 19 ISS1-seq2 GAACCGAAGAAATGGAACGCTC 19 on M arch 22, 2015 by N O R T H E A S T E R N U N IV http://aem .asm .org/ D ow nloaded from was sequenced using primer ISS1-seq1 for the EcoRI chromosomal junction or ISS1-seq2 for the HindIII junction (Table 1). ..
Amplification:Article Title: Random Mutagenesis Identifies Novel Genes Involved in the Secretion of Antimicrobial, Cell Wall-Lytic Enzymes by Lactococcus lactis
Article Snippet: .. Strains, plasmids, and oligonucleotides used in this study Strain, plasmid, or oligonucleotide Details Source, reference, orpurpose Strains E. coli JM109 Cloning host Promega L. lactis MG1363 Plasmid-free L. lactis subsp. cremoris 10 L. lactis MG1363 lss MG1363 carrying the lss cassette on the chromosome This study L. monocytogenes ATCC 19112 Human spinal fluid isolate ATCC S. aureus ATCC 49476 Methicillin-resistant S. aureus 39 Plasmids pBluescript II KSAmpr; 3.0 kb Promega pGEM-3Zf Ampr; 3.2 kb Promega pGEM-T Easy Ampr; 3.0 kb Promega pGhost9:ISS1 Emr ori (Ts); 4.6 kb; nonreplicative in L. lactis at 37°C 19 pSep-6 His-Lss Ampr; pGEM-3Zf containing the PSep–ssSep–six-histidine–lss expression construct (5.3 kb) 39 pBS-his1 Ampr; pBS containing a fragment of the MG1363 his operon on the 5 end of the lss cassette (4.2 kb) This study pGT-his2 Ampr; pGEM-T Easy containing a fragment of the MG1363 his operon on the 3 end of the lss cassette (4.2 kb) This study pGT-his1-lss-his2 Ampr; pGEM-T Easy vector containing the lss cassette within the his operon (6.9 kb) This study pG9-his1-lss-his2 Emr; pGhost9:ISS1 containing the lss cassette within the his operon (7.6 kb) This study pSep511sec Emr; pGhost:ISS1 containing the PSep–ssSep–six-histidine–Ply511 expression construct (5.5 kb) 39 Oligonucleotides His1Sal5 CAGGTCGACCTTTGGGAGTCGCCTTTGGCT Amplification of his1 His1Xba3 TACTCTAGACTGAAACATCAGCCCAGTATA His2Xho5 AGACTCGAGGGCGCAAGCGACTATATCCGG Amplification of his2 His2Eco3 TTCGAATTCTTCTTCGCGCTCCTTGCGGTG lss-Pst AACAGCTGCAGGAGCTGCAACACATGAACATTC 39 His2-DS TGTGATTTGGTACGACGCAGAATTCTAAAGT Amplification of integrated lss ISS1-seq1 CACGATAGCTTAGATTGTAACG 19 ISS1-seq2 GAACCGAAGAAATGGAACGCTC 19 on M arch 22, 2015 by N O R T H E A S T E R N U N IV http://aem .asm .org/ D ow nloaded from was sequenced using primer ISS1-seq1 for the EcoRI chromosomal junction or ISS1-seq2 for the HindIII junction (Table 1). ..
|
ATCC is a verified supplier 
ATCC manufactures this product 